fam135a

Ensembl ID:
ENSDARG00000059843
ZFIN ID:
ZDB-GENE-080130-1
Description:
hypothetical protein LOC566435 [Source:RefSeq peptide;Acc:NP_001139066]
Human Orthologue:
FAM135A
Human Description:
family with sequence similarity 135, member A [Source:HGNC Symbol;Acc:21084]
Mouse Orthologue:
Fam135a
Mouse Description:
family with sequence similarity 135, member A Gene [Source:MGI Symbol;Acc:MGI:1915437]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14063 Essential Splice Site Available for shipment Available now
sa11265 Essential Splice Site Available for shipment Available now
sa42274 Nonsense Mutation detected in F1 DNA During 2016
sa16461 Essential Splice Site Available for shipment Available now
sa38968 Nonsense Mutation detected in F1 DNA During 2016
sa42275 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14063
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083641 Essential Splice Site 181 1338 5 20
ENSDART00000131434 Essential Splice Site 181 1338 7 22
ENSDART00000147971   None 160 None 5
Genomic Location (Zv9):
Chromosome 13 (position 39762036)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39076137
KASP Assay ID:
2260-6827.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCACAATCCATGCTTCACTGGTGGCTCTGCATCAGCCTCTAATAAGG[T/G]CAGTGGTGCACTGAGAACTGGACCGACAGATTGTACTAGTCATTTTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11265
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083641 Essential Splice Site 181 1338 5 20
ENSDART00000131434 Essential Splice Site 181 1338 7 22
ENSDART00000147971   None 160 None 5
Genomic Location (Zv9):
Chromosome 13 (position 39762036)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39076137
KASP Assay ID:
2260-6827.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCACAATCCATGCTTCACTGGTGGCTCTGCATCAGCCTCTAATAAGG[T/G]CAGTGGTGCACTGAGAACTGGACCGACAGATTGTACTAGTCATTTTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42274
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083641 Nonsense 285 1338 8 20
ENSDART00000131434 Nonsense 285 1338 10 22
ENSDART00000147971   None 160 None 5
Genomic Location (Zv9):
Chromosome 13 (position 39768343)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39082444
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTGCAATCCCACCACTAGCCAAGCCCAGCATGCAGGTCCTTTATGAA[C/T]GAGTTCTCAGAAGACCTTACCCTCCAGGCCAAAGGCACGTCTACATAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16461
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083641 Essential Splice Site 301 1338 8 20
ENSDART00000131434 Essential Splice Site 301 1338 10 22
ENSDART00000147971   None 160 None 5
Genomic Location (Zv9):
Chromosome 13 (position 39768393)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39082494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGTTCTCAGAAGACCTTACCCTCCAGGCCAAAGGCACGTCTAYATAGG[T/C]AYGTCCYTCCAAAACCGACCCTAAGCTCCACACGCCTCTTGCCTTTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38968
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083641 Nonsense 315 1338 9 20
ENSDART00000131434 Nonsense 315 1338 11 22
ENSDART00000147971 Nonsense 29 160 2 5
Genomic Location (Zv9):
Chromosome 13 (position 39768817)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39082918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTTTAGAGGAACTTGATGTGGAGGTCCGACTTCATGAGCTTTGTGAA[C/T]AAGTCAAGGTATGGAATGAATTTAAGACTAAAGTTAGACCGTGCATTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083641 Essential Splice Site 1196 1338 17 20
ENSDART00000131434 Essential Splice Site 1196 1338 19 22
ENSDART00000147971   None 160 None 5
Genomic Location (Zv9):
Chromosome 13 (position 39783915)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39098016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACCTCACCTCGGCACACTGTACAACAGCTCAGCACTCGTCAATACTGG[T/C]AACCCGCAGTAGTTTTCTGAAAACAACAGTTTATGAGCTGTTATGTGGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link