MYOM3

Ensembl ID:
ENSDARG00000059838
Description:
myomesin family, member 3 [Source:HGNC Symbol;Acc:26679]
Human Orthologue:
MYOM3
Human Description:
myomesin family, member 3 [Source:HGNC Symbol;Acc:26679]
Mouse Orthologue:
Myom3
Mouse Description:
myomesin family, member 3 Gene [Source:MGI Symbol;Acc:MGI:2685280]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36263 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13988 Nonsense Available for shipment Available now
sa42829 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42830 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083571 Essential Splice Site 659 1285 15 35
Genomic Location:
Chromosome 16 (position 56072840)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCCAGTGAACTACTCTTATGTGAGCCCTGGACCATGCCTGAGCCGGG[T/C]GAGTCACAGTCAACTATGGACAATATTAGAGATTTGACATGCTTTATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13988
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083571 Nonsense 800 1285 18 35
Genomic Location:
Chromosome 16 (position 56080491)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATRAAGGAGTCTTWAGKTGGAATAAAAACWATGGAAAAGCCATTGATGCC[G/T]GACGAGCCCGACTGGAGAACAAAAACAACAGGTCTTYTTTTATTGTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42829
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083571 Essential Splice Site 861 1285 21 35
Genomic Location:
Chromosome 16 (position 56094607)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTCATCATCAGTTATTCCTCACTGTTGTGTCGTGTGTTCGTGTGTGTC[A/C]GTGATCGGTTTGCGCTCTGAGGGCTGGCAGGTGGAGGTGTCAGAGCAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083571 Nonsense 1009 1285 27 35
Genomic Location:
Chromosome 16 (position 56099893)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTGTTCGCCTGCAGGTCACCAACACGAGTAAAGACACACGTCTG[A/T]AGTGGTTTAAGGATGGAGTGGAGCTTCCTCAGGCTGTGTTTGAGCCCTCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link