MYOM3

Ensembl ID:
ENSDARG00000059838
Description:
myomesin family, member 3 [Source:HGNC Symbol;Acc:26679]
Human Orthologue:
MYOM3
Human Description:
myomesin family, member 3 [Source:HGNC Symbol;Acc:26679]
Mouse Orthologue:
Myom3
Mouse Description:
myomesin family, member 3 Gene [Source:MGI Symbol;Acc:MGI:2685280]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13988 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13988
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083571 Nonsense 800 1285 18 35
Genomic Location:
Chromosome 16 (position 56080491)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATRAAGGAGTCTTWAGKTGGAATAAAAACWATGGAAAAGCCATTGATGCC[G/T]GACGAGCCCGACTGGAGAACAAAAACAACAGGTCTTYTTTTATTGTCATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pjqeelkh