LOC569146

Ensembl ID:
ENSDARG00000059822
Human Orthologue:
KCNJ12
Human Description:
potassium inwardly-rectifying channel, subfamily J, member 12 [Source:HGNC Symbol;Acc:6258]
Mouse Orthologue:
Kcnj12
Mouse Description:
potassium inwardly-rectifying channel, subfamily J, member 12 Gene [Source:MGI Symbol;Acc:MGI:108495

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44191 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44191
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083591 Nonsense 64 438 1 1
Genomic Location (Zv9):
Chromosome 24 (position 40979043)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39466796
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTCGTCAAGAAGAACGGACAGTGCAATGTGCAGTTCACCAACATGGAC[G/T]AGAAGTCCCAGCGATACATGGCGGACATATTCACCACTTGCGTGGACATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link