LOC799274

Ensembl ID:
ENSDARG00000059818
Human Orthologue:
KIF5A
Human Description:
kinesin family member 5A [Source:HGNC Symbol;Acc:6323]
Mouse Orthologue:
Kif5a
Mouse Description:
kinesin family member 5A Gene [Source:MGI Symbol;Acc:MGI:109564]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17684 Nonsense Available for shipment Available now
sa7055 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9911 Nonsense Available for shipment Available now
sa16963 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17684
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090634 Nonsense 222 992 8 26
Genomic Location:
Chromosome 6 (position 58694413)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCACAGYATATTCCTGATCAACATTAAGCAGGAGCATGTGGAGACMRAG[C/T]AGAAACTCTGTGGAAAACTCTACCTGGTGGAWCTGGCCGGCAGCGAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090634 Essential Splice Site 238 992 8 26
Genomic Location:
Chromosome 6 (position 58694361)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACTCTGTGGAAAACTCTACCTGGTGGATCTGGCCGGCAGCGAGAAGG[T/G]CATTCAGTGTRTTTRTGTYTTCATCACACACACACACACACACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9911
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090634 Nonsense 621 992 16 26
Genomic Location:
Chromosome 6 (position 58683684)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGGAGAGYCTACAGACCGACTGTCACCRAAAGATGGAGGAGACCGGC[A/T]GAGAACTGTYCTCCTGTCAGCTGCTYATYTCACAGGTMACACACACACAS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16963
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090634 Essential Splice Site 632 992 16 26
Genomic Location:
Chromosome 6 (position 58683647)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGAGACCGGCWGAGAACTGTYCTCCTGTCAGCTGCTYATYTCACAGG[T/C]MACACACACACASASACACACACASACACACACACAGACACACACACACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z5y6fz2q