mtmr12

Ensembl ID:
ENSDARG00000059817
ZFIN ID:
ZDB-GENE-050401-1
Description:
Myotubularin-related protein 12 [Source:UniProtKB/Swiss-Prot;Acc:A2BGG1]
Human Orthologue:
MTMR12
Human Description:
myotubularin related protein 12 [Source:HGNC Symbol;Acc:18191]
Mouse Orthologues:
Mtmr12, Sbf2
Mouse Descriptions:
myotubularin related protein 12 Gene [Source:MGI Symbol;Acc:MGI:2443034]
SET binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:1921831]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25309 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6059 Nonsense Mutation detected in F1 DNA During 2014
sa2252 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa25309
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083561 Essential Splice Site 354 736 11 16
Genomic Location:
Chromosome 5 (position 42731574)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAAATGGTTCTCTTCTCTTGAGAGCTCAGGATGGCTGGACATCATTAG[G/T]TCAGTTTACTTGAAGAAAGCCTGAAATTGTGTGATTTACTCTATGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083561 Nonsense 424 736 13 16
Genomic Location:
Chromosome 5 (position 42729072)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGTCTGGTGCAGAAGGAGTGGGTGGCTGGTTGCCATGCCTTCCTGGAT[C/T]GATGCAATCACCTCCATCAGAAAGACAAGGAGGTAATTATTGCATGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2252
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083561 Nonsense 676 736 16 16
Genomic Location:
Chromosome 5 (position 42724951)
KASP Assay ID:
554-3391.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGGATCTGAAGCGTGTGCTGGAGCAGAGAGACCCATCGCTGGCCACT[C/T]AACCCGATCACCCTCCACCTCTTCACCATCGGCTGCCCTCATTYGGTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/49a0ap45