cask

Ensembl ID:
ENSDARG00000059809
ZFIN ID:
ZDB-GENE-020802-4
Description:
peripheral plasma membrane protein CASK [Source:RefSeq peptide;Acc:NP_694420]
Human Orthologue:
CASK
Human Description:
calcium/calmodulin-dependent serine protein kinase (MAGUK family) [Source:HGNC Symbol;Acc:1497]
Mouse Orthologue:
Cask
Mouse Description:
calcium/calmodulin-dependent serine protein kinase (MAGUK family) Gene [Source:MGI Symbol;Acc:MGI:13

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17097 Essential Splice Site Available for shipment Available now
sa2530 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1081 Nonsense F2 line generated During 2014
sa14058 Essential Splice Site Available for shipment Available now
sa11434 Essential Splice Site Available for shipment Available now
sa3721 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17097
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040843 Essential Splice Site 124 899 4 27
ENSDART00000100849 Essential Splice Site 130 907 5 26
ENSDART00000144150 Essential Splice Site 124 901 4 25

The following transcripts of ENSDARG00000059809 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 34472585)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCGCTGCGGTATTGCCATGACAACAACATCATTCACCGGGATGTGAAG[G/A]WAAATTCAGYGATGTCTCACTGCTTCAGATTACCATGAATTTGACGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2530
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040843 Essential Splice Site 124 899 4 27
ENSDART00000100849 Essential Splice Site 130 907 5 26
ENSDART00000144150 Essential Splice Site 124 901 4 25

The following transcripts of ENSDARG00000059809 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 34472584)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGCTGCGGTATTGCCATGACAACAACATCATTCACCGGGATGTGAAGG[T/A]AAATTCAGTGATGTCTCACTGCTTCAGATTACCATGAATTTGACGAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1081
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040843 Nonsense 522 899 15 27
ENSDART00000100849 Nonsense 528 907 16 26
ENSDART00000144150 Nonsense 522 901 15 25

The following transcripts of ENSDARG00000059809 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 34423321)
KASP Assay ID:
554-0983.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACACATTGGAGAYGAGATCCGGGAGATCAACGGTATAAGTGTAGCAAAT[C/T]AAACAGTGGAGCAGCTTCAGAAAATGCTTGTGAGTARTAATATATTTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14058
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040843 Essential Splice Site 555 899 None 27
ENSDART00000100849 Essential Splice Site 561 907 None 26
ENSDART00000144150 Essential Splice Site 555 901 None 25

The following transcripts of ENSDARG00000059809 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 34421380)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTAGTGTTCGTTTGCTCTGCTGTTTCGCTGACCTTTATATCTTAYTAC[A/T]GAAAGAATCCCCTTCCACATCCAGACAGTCCCCTGCTAATGGCCATTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11434
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040843 Essential Splice Site 577 899 None 27
ENSDART00000100849 Essential Splice Site 583 907 None 26
ENSDART00000144150 Essential Splice Site 577 901 None 25

The following transcripts of ENSDARG00000059809 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 34421308)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGACAGTCCCCTGCTAATGGCCATTCCAGCATTAACAGTTCTATCTTGG[T/C]AAGGATCCAAGACAACTTCAAATAACGACCCCTCTTCCCACCCCCCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040843 Essential Splice Site 813 899 25 27
ENSDART00000100849 Essential Splice Site 821 907 24 26
ENSDART00000144150 Essential Splice Site 815 901 23 25

The following transcripts of ENSDARG00000059809 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 34403656)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAAATCCATGAGCAGGGACTCATAGCCATACTGGACGTAGAGCCACAG[G/A]TGAACGTTTAGAGATTTTTAATGAGAGAAGTTGCTCATACAGTAACCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4wjm48tz