fam134c

Ensembl ID:
ENSDARG00000059804
ZFIN ID:
ZDB-GENE-080520-1
Description:
Fam134c protein [Source:UniProtKB/TrEMBL;Acc:A9JTG3]
Human Orthologue:
FAM134C
Human Description:
family with sequence similarity 134, member C [Source:HGNC Symbol;Acc:27258]
Mouse Orthologue:
Fam134c
Mouse Description:
family with sequence similarity 134, member C Gene [Source:MGI Symbol;Acc:MGI:1915248]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38404 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38404
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125611 Nonsense 325 500 9 9
Genomic Location (Zv9):
Chromosome 3 (position 37098148)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36961508
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCACTATTTATTCAATTAATAGATCTCGATAGACATAGCGATCCGGAA[G/T]AATCATTTGCCTGTGGGCTCCCAGACTTTCCCTCCATAAACCCAGATGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link