kcnq1

Ensembl ID:
ENSDARG00000059798
ZFIN ID:
ZDB-GENE-061214-5
Description:
potassium voltage-gated channel subfamily KQT member 1 [Source:RefSeq peptide;Acc:NP_001116714]
Human Orthologue:
KCNQ1
Human Description:
potassium voltage-gated channel, KQT-like subfamily, member 1 [Source:HGNC Symbol;Acc:6294]
Mouse Orthologue:
Kcnq1
Mouse Description:
potassium voltage-gated channel, subfamily Q, member 1 Gene [Source:MGI Symbol;Acc:MGI:108083]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40998 Essential Splice Site Mutation detected in F1 DNA During 2017
sa27036 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38635 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40998
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083514 Essential Splice Site 127 655 2 18
ENSDART00000083516 Essential Splice Site 127 643 2 17
ENSDART00000125483 Essential Splice Site 127 485 2 12
Genomic Location (Zv9):
Chromosome 7 (position 50033671)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48303907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCATCGACGAGTATCAAGCACTGGCTAATAAAACACTATTCTGGATGG[T/C]GAGTCTGACAAAATGTTATTAAACTGAACTAAATCAATATGCTTCCTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27036
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083514 Essential Splice Site 196 655 4 18
ENSDART00000083516 Essential Splice Site 196 643 4 17
ENSDART00000125483 Essential Splice Site 196 485 4 12
Genomic Location (Zv9):
Chromosome 7 (position 50049095)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48319331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTGGCATTTGGCTCTAATGGCCAGGTATTTGCTACCTCTGCTGTCAG[G/A]TAAGGTTAATATAACAAATAAGTCACTGTGGTCTCTTTATACATTGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38635
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083514 Essential Splice Site 378 655 9 18
ENSDART00000083516 Essential Splice Site 378 643 9 17
ENSDART00000125483 Essential Splice Site 378 485 9 12
Genomic Location (Zv9):
Chromosome 7 (position 50054585)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48324821
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTGTGAAACGAAATCTCAGCAGTTCAGGGTCTAGCCCTAAATTAAAG[G/A]TAGGCTACCAAACTATTCTGAGATGCCTGCATAAATCTACAAGAACAAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Electrocardiographic traits: Several common variants modulate heart rate, PR interval and QRS duration. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Platelet aggregation: Genome-wide meta-analyses identifies seven loci associated with platelet aggregation in response to agonists. (View Study)
  • Protein quantitative trait loci: A genome-wide association study identifies protein quantitative trait loci (pQTLs). (View Study)
  • QT interval: Common variants at ten loci influence QT interval duration in the QTGEN Study. (View Study)
  • QT interval: Common variants at ten loci modulate the QT interval duration in the QTSCD Study. (View Study)
  • QT interval: Impact of ancestry and common genetic variants on QT interval in African Americans. (View Study)
  • Type 2 diabetes: A genome-wide association study confirms previously reported loci for type 2 diabetes in Han Chinese. (View Study)
  • Type 2 diabetes: A genome-wide association study identifies GRK5 and RASGRP1 as type 2 diabetes loci in Chinese Hans. (View Study)
  • Type 2 diabetes: A genome-wide association study identifies susceptibility variants for type 2 diabetes in Han Chinese. (View Study)
  • Type 2 diabetes: Confirmation of multiple risk Loci and genetic impacts by a genome-wide association study of type 2 diabetes in the Japanese population. (View Study)
  • Type 2 diabetes: Genome-wide association study of type 2 diabetes in a sample from Mexico City and a meta-analysis of a Mexican-American sample from Starr County, Texas. (View Study)
  • Type 2 diabetes: SNPs in KCNQ1 are associated with susceptibility to type 2 diabetes in East Asian and European populations. (View Study)
  • Type 2 diabetes: Twelve type 2 diabetes susceptibility loci identified through large-scale association analysis. (View Study)
  • Type 2 diabetes: Variants in KCNQ1 are associated with susceptibility to type 2 diabetes mellitus. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link