si:ch73-52e5.1

Ensembl ID:
ENSDARG00000059795
ZFIN ID:
ZDB-GENE-070912-340
Description:
hypothetical protein LOC569944 [Source:RefSeq peptide;Acc:NP_001116176]
Human Orthologue:
C8orf55
Human Description:
chromosome 8 open reading frame 55 [Source:HGNC Symbol;Acc:29656]
Mouse Orthologue:
4930572J05Rik
Mouse Description:
RIKEN cDNA 4930572J05 gene Gene [Source:MGI Symbol;Acc:MGI:1925301]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19900 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19900
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083520 Nonsense 119 204 1 2
ENSDART00000138530 Nonsense 120 205 2 3
Genomic Location (Zv9):
Chromosome 2 (position 52315499)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 51368362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGCTACAGACGGCCGCTGTGTGTCGGCGAGGCGTTTGAGCTGCGCAGT[C/T]GAATCGTCAGCTGGGATGAGAAATCCTTTTATCTGGAGCAGCGCTTCGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link