trpm5

Ensembl ID:
ENSDARG00000059792
ZFIN ID:
ZDB-GENE-060503-736
Description:
transient receptor potential cation channel subfamily M member 5 [Source:RefSeq peptide;Acc:NP_0011
Human Orthologue:
TRPM5
Human Description:
transient receptor potential cation channel, subfamily M, member 5 [Source:HGNC Symbol;Acc:14323]
Mouse Orthologue:
Trpm5
Mouse Description:
transient receptor potential cation channel, subfamily M, member 5 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34168 Nonsense Mutation detected in F1 DNA During 2016
sa17123 Essential Splice Site Available for shipment Available now
sa10868 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34168
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083473 Nonsense 490 1160 10 24
Genomic Location:
Chromosome 7 (position 50141644)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGAAAAGGCAGACTTTTCCACAGCCAGAAAAACCTTCCAGACATGGAC[A/T]GACGATGTGAGCACCCTTGGAGAGACCTCTTCCTTTGGGCTATTCTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17123
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083473 Essential Splice Site 965 1160 20 24
Genomic Location:
Chromosome 7 (position 50154339)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTMATTAAAAAAGGAAAATGTAACTAATCATCTTGTCACCCCTCTTCAC[A/G]GCTACACRTTYCAAGTGGTGCAGGAGAATGCAGATATCTTCTGGAAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10868
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083473 Nonsense 1050 1160 21 24
Genomic Location:
Chromosome 7 (position 50154835)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGAAGCTCATGACATGGGAGACGGTGCAGAAAGAGMACTATCTGGCT[A/T]AACTGGAGCATGAGCACAGAGAGAGCAGCGGAGAGAGACTCAGATACACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link