trpm5

Ensembl ID:
ENSDARG00000059792
ZFIN ID:
ZDB-GENE-060503-736
Description:
transient receptor potential cation channel subfamily M member 5 [Source:RefSeq peptide;Acc:NP_0011
Human Orthologue:
TRPM5
Human Description:
transient receptor potential cation channel, subfamily M, member 5 [Source:HGNC Symbol;Acc:14323]
Mouse Orthologue:
Trpm5
Mouse Description:
transient receptor potential cation channel, subfamily M, member 5 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17123 Essential Splice Site Available for shipment Available now
sa10868 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17123
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083473 Essential Splice Site 965 1160 20 24
Genomic Location:
Chromosome 7 (position 50154339)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTMATTAAAAAAGGAAAATGTAACTAATCATCTTGTCACCCCTCTTCAC[A/G]GCTACACRTTYCAAGTGGTGCAGGAGAATGCAGATATCTTCTGGAAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10868
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083473 Nonsense 1050 1160 21 24
Genomic Location:
Chromosome 7 (position 50154835)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGAAGCTCATGACATGGGAGACGGTGCAGAAAGAGMACTATCTGGCT[A/T]AACTGGAGCATGAGCACAGAGAGAGCAGCGGAGAGAGACTCAGATACACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2flo7x2m