dad1

Ensembl ID:
ENSDARG00000059791
ZFIN ID:
ZDB-GENE-060503-233
Description:
dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit DAD1 [Source:RefSeq peptide;
Human Orthologue:
DAD1
Human Description:
defender against cell death 1 [Source:HGNC Symbol;Acc:2664]
Mouse Orthologue:
Dad1
Mouse Description:
defender against cell death 1 Gene [Source:MGI Symbol;Acc:MGI:101912]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33048 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33048
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083505 Essential Splice Site 71 113 1 3
Genomic Location (Zv9):
Chromosome 2 (position 51762326)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 52051003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTCTTATCTGGCTTCATTTCATGTGTGGGGTCCTTCATACTGGCTGG[T/A]ATGTACTTTTTTAATTTTTATCACATATACCATATGTATGTAGTTTTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link