A0PJS2_DANRE

Ensembl ID:
ENSDARG00000059784
Description:
LOC798528 protein [Source:UniProtKB/TrEMBL;Acc:A0PJS2]
Human Orthologue:
DENND4B
Human Description:
DENN/MADD domain containing 4B [Source:HGNC Symbol;Acc:29044]
Mouse Orthologue:
Dennd4b
Mouse Description:
DENN/MADD domain containing 4B Gene [Source:MGI Symbol;Acc:MGI:2446201]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10314 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10314
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083464 Essential Splice Site 434 1473 8 27
ENSDART00000114726 Essential Splice Site 434 704 9 15
Genomic Location:
Chromosome 16 (position 58250362)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGCTGCGGCCYGACGTGCTGACGTCTGTGAGTGAAGCACTGCTGTCGG[T/G]GAGTCCCCAGCYCAGCTCAGCTCACACACACAGATCAGATTAGACACTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lentiform nucleus volume : Genome-wide association identifies genetic variants associated with lentiform nucleus volume in N = 1345 young and elderly subjects. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p3v1tkoj