atcayb

Ensembl ID:
ENSDARG00000059781
ZFIN ID:
ZDB-GENE-070912-220
Human Orthologue:
ATCAY
Human Description:
ataxia, cerebellar, Cayman type [Source:HGNC Symbol;Acc:779]
Mouse Orthologue:
Atcay
Mouse Description:
ataxia, cerebellar, Cayman type homolog (human) Gene [Source:MGI Symbol;Acc:MGI:2448730]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19908 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19908
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083470 Essential Splice Site 116 339 3 11
ENSDART00000136629 Essential Splice Site 61 252 1 6
Genomic Location:
Chromosome 2 (position 56146381)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGACTCTCTTGGCTCTGCCAACAACGGCACCGAGCTGGAATGGGAAG[G/A]TCAGTCTCTTCCACTGATGTTTTTACTTCACTTTTGTGCTTAAGCACTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qh6tzh79