si:ch211-278a6.1

Ensembl ID:
ENSDARG00000059773
ZFIN ID:
ZDB-GENE-060503-699
Description:
Novel protein similar to vertebrate SNAP25-interacting protein (SNIP) [Source:UniProtKB/TrEMBL;Acc:A
Human Orthologue:
SRCIN1
Human Description:
SRC kinase signaling inhibitor 1 [Source:HGNC Symbol;Acc:29506]
Mouse Orthologue:
Srcin1
Mouse Description:
SRC kinase signaling inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1933179]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40119 Nonsense Mutation detected in F1 DNA During 2017
sa26123 Essential Splice Site Mutation detected in F1 DNA During 2017
sa18245 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083442 Nonsense 104 997 2 15
ENSDART00000148107 Nonsense 277 1052 5 13
Genomic Location (Zv9):
Chromosome 3 (position 37308590)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37171950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATGAAGCCAGAAATGTCTTCTACGAGCTGGAGGATGTGAGGGACATA[C/T]AGGACCGCAGCATCATCAAAATCTATCGCAAAGAACCCATCTACGCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26123
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083442 Essential Splice Site 764 997 11 15
ENSDART00000148107 Essential Splice Site 912 1052 12 13
Genomic Location (Zv9):
Chromosome 3 (position 37262879)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37126239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGAGGAAGAGGAGGGTCTGAGAAAGCCTCATCTGTGGAAGTCAGACTGG[T/G]GAGGATAGAGATTTCATTGTTTCCCTGTTTCAATGGAAATTACCAAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18245
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083442 Nonsense 826 997 12 15
ENSDART00000148107 Nonsense 974 1052 13 13
Genomic Location (Zv9):
Chromosome 3 (position 37261144)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37124504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCAAACCTGCTCAGAACCAGAATCAGAAYCAGAACCAGAACCCAAAC[C/T]AAAACCAGAATCCAAGTCCATCCAGCACCAATGCCACACCTGAACACAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link