gpatch8

Ensembl ID:
ENSDARG00000059768
ZFIN ID:
ZDB-GENE-030131-6966
Description:
LOC565404 protein [Source:UniProtKB/TrEMBL;Acc:A4QP17]
Human Orthologue:
GPATCH8
Human Description:
G patch domain containing 8 [Source:HGNC Symbol;Acc:29066]
Mouse Orthologue:
Gpatch8
Mouse Description:
G patch domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1918667]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa769 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa769
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108937 Nonsense 914 1431 11 12
Genomic Location (Zv9):
Chromosome 3 (position 37661303)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37524663
KASP Assay ID:
554-0674.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTAGTCGCAGCTCCAGTCGAAGTAGTTGGAGTAGCAGTGCTCGTTCTTA[C/A]AGACGCAGTAGCTACAGTCGCAGCCGTAGCTCTGCTAGTCGTTCATCTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link