gabrd

Ensembl ID:
ENSDARG00000059763
ZFIN ID:
ZDB-GENE-081105-170
Description:
Novel protein similar to H.sapiens GABRD, gamma-aminobutyric acid (GABA) A receptor, delta (GABRD) [
Human Orthologue:
GABRD
Human Description:
gamma-aminobutyric acid (GABA) A receptor, delta [Source:HGNC Symbol;Acc:4084]
Mouse Orthologue:
Gabrd
Mouse Description:
gamma-aminobutyric acid (GABA) A receptor, subunit delta Gene [Source:MGI Symbol;Acc:MGI:95622]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30910 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34523 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083416 Essential Splice Site 158 459 None 9
ENSDART00000132000 Essential Splice Site 168 469 None 9

The following transcripts of ENSDARG00000059763 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 55314728)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53312846
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAACTCATACGCCTGCAGCCTGACGGAGTCATTCTCTACAGCAGTCGG[T/C]ACGCCAGTGTGTGTGTGTTTACAGGAGCTCAGTGTCACAATGTTTCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34523
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083416 Essential Splice Site 186 459 5 9
ENSDART00000132000 Essential Splice Site 196 469 5 9

The following transcripts of ENSDARG00000059763 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 55315263)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53312311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAAATACCCCATGGATGAGCAGGAATGCATGCTAGACCTTGAAAGCTG[T/G]GAGTAAGAAGAAAACACACACAACTGCATCTCTCATTCATTTGACATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link