LOC559451

Ensembl ID:
ENSDARG00000059751
Human Orthologue:
ABTB2
Human Description:
ankyrin repeat and BTB (POZ) domain containing 2 [Source:HGNC Symbol;Acc:23842]
Mouse Orthologue:
Abtb2
Mouse Description:
ankyrin repeat and BTB (POZ) domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2139365]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13965 Nonsense Available for shipment Available now
sa21057 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13965
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083389 Nonsense 12 1007 1 17
Genomic Location:
Chromosome 7 (position 50729881)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTCTACTAATAGACATGGCAGCTGTGAGCAATTCTACTATGAAGACTT[T/A]GGAGGATTTGACTCTAGACTCTGGATATGGAGCCGGCGACTCGTACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21057
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083389 Essential Splice Site 575 1007 8 17
Genomic Location:
Chromosome 7 (position 50766791)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGACTGTGGCATGACTTTAGCATGCTAAATAACTTTGTTTGCATTTC[A/G]GCTGCTGTTAGATGTGGGAGCAGATGTGGAGGGCAGAGCCCTGAGAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z9o3c1eo