LOC559451

Ensembl ID:
ENSDARG00000059751
Human Orthologue:
ABTB2
Human Description:
ankyrin repeat and BTB (POZ) domain containing 2 [Source:HGNC Symbol;Acc:23842]
Mouse Orthologue:
Abtb2
Mouse Description:
ankyrin repeat and BTB (POZ) domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2139365]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13965 Nonsense Available for shipment Available now
sa27042 Essential Splice Site Mutation detected in F1 DNA During 2015
sa21057 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa13965
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083389 Nonsense 12 1007 1 17
Genomic Location:
Chromosome 7 (position 50729881)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTCTACTAATAGACATGGCAGCTGTGAGCAATTCTACTATGAAGACTT[T/A]GGAGGATTTGACTCTAGACTCTGGATATGGAGCCGGCGACTCGTACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27042
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083389 Essential Splice Site 575 1007 8 17
ENSDART00000083389 Essential Splice Site 575 1007 8 17
Genomic Location:
Chromosome 7 (position 50766791)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGACTGTGGCATGACTTTAGCATGCTAAATAACTTTGTTTGCATTTC[A/C]GCTGCTGTTAGATGTGGGAGCAGATGTGGAGGGCAGAGCCCTGAGAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21057
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083389 Essential Splice Site 575 1007 8 17
ENSDART00000083389 Essential Splice Site 575 1007 8 17
Genomic Location:
Chromosome 7 (position 50766791)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGACTGTGGCATGACTTTAGCATGCTAAATAACTTTGTTTGCATTTC[A/C]GCTGCTGTTAGATGTGGGAGCAGATGTGGAGGGCAGAGCCCTGAGAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z9o3c1eo