plod1a

Ensembl ID:
ENSDARG00000059746
ZFIN ID:
ZDB-GENE-030131-3165
Description:
procollagen-lysine,2-oxoglutarate 5-dioxygenase 1 [Source:RefSeq peptide;Acc:NP_001071210]
Human Orthologue:
PLOD1
Human Description:
procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1 [Source:HGNC Symbol;Acc:9081]
Mouse Orthologue:
Plod1
Mouse Description:
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 Gene [Source:MGI Symbol;Acc:MGI:99907]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21385 Essential Splice Site Available for shipment Available now
sa25408 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31681 Nonsense Available for shipment Available now
sa13867 Essential Splice Site Available for shipment Available now
sa14077 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21385
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083395 Essential Splice Site 251 730 8 19
ENSDART00000147159   None 50 None 4

The following transcripts of ENSDARG00000059746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 50034276)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47886253
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACTGTCTTCAGTTCAACCTGATTTATTTTGTGCTCTTTTTTTTCTTCA[G/A]CTTCAGATAAACTACCTAGGGAACTACATCCCGAATCTGTGGACATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25408
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083395 Essential Splice Site 404 730 11 19
ENSDART00000147159   None 50 None 4

The following transcripts of ENSDARG00000059746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 50037472)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47889449
KASP Assay ID:
554-7428.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTTTAAAGAACGAAGACACACTTAGAATCCTAATTGAGCACAACAAG[T/C]GAGTGAAGCGCCTGTACCTGTTTAATTAGGGCAGATTGTGAATTGTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31681
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083395 Nonsense 536 730 15 19
ENSDART00000147159   None 50 None 4

The following transcripts of ENSDARG00000059746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 50043016)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47894993
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATTTTTTGTCTTATACTTTTTTTTCTGTGAAACAGGAATGGGAGGAA[C/T]GATACATTCATCCAAATTATTCCAGAGTTTTAAAAGACGAGTTTATAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13867
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083395 Essential Splice Site 553 730 None 19
ENSDART00000147159   None 50 None 4
ENSDART00000083395 Essential Splice Site 553 730 None 19
ENSDART00000147159   None 50 None 4

The following transcripts of ENSDARG00000059746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 50043071)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47895048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTCATCCAAATTATTCCAGAGTTTTAAAAGACGAGTTWATAGAAACAG[T/C]GAGTATTCACCCAAGCAATAAAATTACACAATCTATGAATTGACCCTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14077
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083395 Essential Splice Site 553 730 None 19
ENSDART00000147159   None 50 None 4
ENSDART00000083395 Essential Splice Site 553 730 None 19
ENSDART00000147159   None 50 None 4

The following transcripts of ENSDARG00000059746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 50043071)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47895048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTCATCCAAATTATTCCAGAGTTTTAAAAGACGAGTTWATAGAAACAG[T/C]GAGTATTCACCCAAGCAATAAAATTACACAATCTATGAATTGACCCTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link