LOC100333928

Ensembl ID:
ENSDARG00000059741
Human Orthologue:
ALPK1
Human Description:
alpha-kinase 1 [Source:HGNC Symbol;Acc:20917]
Mouse Orthologue:
Alpk1
Mouse Description:
alpha-kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1918731]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18143 Essential Splice Site Available for shipment Available now
sa20845 Nonsense Mutation detected in F1 DNA During 2014
sa20844 Nonsense Mutation detected in F1 DNA During 2014
sa20843 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18143
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101799 Essential Splice Site 257 1515 7 13
Genomic Location:
Chromosome 7 (position 1086661)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAATGAGCGAGACTTCACGGCGCTCCAGAATAAACCACATAKTAAACTG[G/A]TAATTAGSTCTGAATGTTGGCTGGGTAGTARTGGATTACATCCAANNNGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101799 Nonsense 502 1515 9 13
Genomic Location:
Chromosome 7 (position 1082831)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGGTTTCCACATGCCGTCATTCTCATGCAGATTCCATCAAGCAGACT[C/T]GATCTAATAGCAAAAAGGTTGGTCAAAACTCTCACAACACATGCAGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101799 Nonsense 1075 1515 9 13
Genomic Location:
Chromosome 7 (position 1081112)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTAACAGAGGATGTTGAAGATGAGACACCAAATACATCAACTGCACAA[C/T]AGAAAGACATTAGGAATAACCTGGGACCAAGAACATCTTCAAGTTCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20843
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101799 Nonsense 1212 1515 9 13
Genomic Location:
Chromosome 7 (position 1080701)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCATTTGAGGAGCTGGGATTTGAAGATCTGTCTTTACTCAACAACCAT[C/T]AGAAAACGAGGAGCTCCATCAAACCTTCCTCTACCGGAGGGGATGCACCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/thsyradb