ptprsa

Ensembl ID:
ENSDARG00000059738
ZFIN ID:
ZDB-GENE-020107-3
Description:
Receptor protein-tyrosine phosphatase sigma [Source:UniProtKB/TrEMBL;Acc:Q90YJ4]
Human Orthologue:
PTPRS
Human Description:
protein tyrosine phosphatase, receptor type, S [Source:HGNC Symbol;Acc:9681]
Mouse Orthologue:
Ptprs
Mouse Description:
protein tyrosine phosphatase, receptor type, S Gene [Source:MGI Symbol;Acc:MGI:97815]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10109 Essential Splice Site Available for shipment Available now
sa17813 Nonsense Available for shipment Available now
sa13576 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10109
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083308 Essential Splice Site 1394 1902 21 31
ENSDART00000136798   None 169 None 3
ENSDART00000145114 Essential Splice Site 1289 1797 20 30
Genomic Location (Zv9):
Chromosome 22 (position 3406864)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 3404178
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGTCATCGCCTACGACCAYTCCCGCGTAATCCTGGCACCCATCGAAGG[T/A]CAGGGAAAGCTTGCACACACAAACACATACATGCCGATTCTTGAAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17813
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083308 Nonsense 1613 1902 25 31
ENSDART00000136798   None 169 None 3
ENSDART00000145114 Nonsense 1508 1797 24 30
Genomic Location (Zv9):
Chromosome 22 (position 3388979)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 3386293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGATGCCCTCCTGGAGGCTGTAGCCTGCGGGAACACCGAGGTGGCGGCA[C/T]GAAGCCTCTTCTCCTACATCCAGAAGCTGGCACAGGTGGAGGCAGGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13576
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083308 Nonsense 1679 1902 26 31
ENSDART00000136798   None 169 None 3
ENSDART00000145114 Nonsense 1574 1797 25 30
Genomic Location (Zv9):
Chromosome 22 (position 3385472)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 3382786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACCGCCTGGTTAACATCAWGCCGTACGAGACCACTCGAGTGTGCCTG[C/T]AGCCAATCAGAGGGCTGGAGGGCTCCGACTACATCAACTCCAGCTTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link