NP_001165699.1

Ensembl ID:
ENSDARG00000059735
Description:
diacylglycerol kinase epsilon [Source:RefSeq peptide;Acc:NP_001165699]
Human Orthologue:
DGKE
Human Description:
diacylglycerol kinase, epsilon 64kDa [Source:HGNC Symbol;Acc:2852]
Mouse Orthologue:
Dgke
Mouse Description:
diacylglycerol kinase, epsilon Gene [Source:MGI Symbol;Acc:MGI:1889276]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20679 Essential Splice Site Available for shipment Available now
sa26723 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20679
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083369 Essential Splice Site 394 566 7 11
Genomic Location (Zv9):
Chromosome 6 (position 19533989)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 21905082
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACAGAGAAAAAACACCCTCCTTTTTCTCCAGCCGAATAATCAATAAGG[T/G]CTGTGGCTTTGCCTGTCTGTCTTTTTATTTTTAAACTTAAAGGAAAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26723
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083369 Essential Splice Site 498 566 10 11
Genomic Location (Zv9):
Chromosome 6 (position 19531089)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 21907982
KASP Assay ID:
554-6460.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGAAACTGGCCAATCCTGTGAGGCTGGGACAAGCACATACAGTCCGGG[T/A]GAGAGCATAAGCATGTTCTTTATTAAAACAGCATTAATGGTGTGAAAAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link