si:ch211-89f7.1

Ensembl ID:
ENSDARG00000059729
ZFIN ID:
ZDB-GENE-060526-180
Description:
SEC14-like protein 3 [Source:RefSeq peptide;Acc:NP_001093463]
Human Orthologues:
RP4-539M6.17, RP4-539M6.19, SEC14L2, SEC14L3, SEC14L4
Human Descriptions:
SEC14-like [Source:RefSeq peptide;Acc:NP_001180265]
SEC14-like 2 (S. cerevisiae) [Source:HGNC Symbol;Acc:10699]
SEC14-like 3 (S. cerevisiae) [Source:HGNC Symbol;Acc:18655]
SEC14-like 4 (S. cerevisiae) [Source:HGNC Symbol;Acc:20627]
Mouse Orthologues:
Sec14l2, Sec14l3, Sec14l4
Mouse Descriptions:
SEC14-like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915065]
SEC14-like 3 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:3617848]
SEC14-like 4 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2144095]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20358 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20358
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083359 Nonsense 365 395 12 12

The following transcripts of ENSDARG00000059729 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 14670416)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12967853
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACATGTATTTTGAATTTCTGTCCTGTCTTCATTCTCCTAGATGTCCTG[C/T]GATTTGACAACACATACAGCGTCTTCCAGTCCAAAACGGTCAAATTTACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link