lrrc8c

Ensembl ID:
ENSDARG00000059718
ZFIN ID:
ZDB-GENE-030131-2965
Human Orthologue:
LRRC8C
Human Description:
leucine rich repeat containing 8 family, member C [Source:HGNC Symbol;Acc:25075]
Mouse Orthologue:
Lrrc8c
Mouse Description:
leucine rich repeat containing 8 family, member C Gene [Source:MGI Symbol;Acc:MGI:2140839]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40672 Nonsense Mutation detected in F1 DNA During 2016
sa26729 Nonsense Mutation detected in F1 DNA During 2016
sa20688 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083330 Nonsense 251 792 2 2
Genomic Location (Zv9):
Chromosome 6 (position 21403923)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 25091654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAATTTCGCCTACATGTGGAAGAGGGTGATATACTATATATGATGTA[T/A]GTTCGCCAGACTGTCGTAAAAGTGCTGAAGTTTATCCTTATAATTGCGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083330 Nonsense 418 792 2 2
Genomic Location (Zv9):
Chromosome 6 (position 21403424)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 25091155
KASP Assay ID:
2259-7450.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGCTTCGGCAGAAGCTGCAGACTAACAGCAATAACAGGCTAGAACTT[C/T]AACTCTTCATGCTGTATGGTCTCCCTGATACCATCTTTGAGGTGACTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083330 Nonsense 547 792 2 2
Genomic Location (Zv9):
Chromosome 6 (position 21403037)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 25090768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAGCGTTGAAGACCCTGACACTCAAGAGCAACTTCACCAAAATCCCA[C/T]AGTCCATCGTAGATGTGGCCAGCCATCTACAACGCCTCAGTATTTGCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link