nol6

Ensembl ID:
ENSDARG00000059711
ZFIN ID:
ZDB-GENE-030131-6294
Description:
nucleolar protein family 6 [Source:RefSeq peptide;Acc:NP_001154983]
Human Orthologue:
NOL6
Human Description:
nucleolar protein family 6 (RNA-associated) [Source:HGNC Symbol;Acc:19910]
Mouse Orthologue:
Nol6
Mouse Description:
nucleolar protein family 6 (RNA-associated) Gene [Source:MGI Symbol;Acc:MGI:2140151]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12332 Essential Splice Site Available for shipment Available now
sa841 Essential Splice Site Available for shipment Available now
sa38501 Essential Splice Site Mutation detected in F1 DNA During 2017
sa962 Essential Splice Site F2 line generated During 2017
sa40553 Essential Splice Site Mutation detected in F1 DNA During 2017
sa26570 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa7003 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38502 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12332
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083294 Essential Splice Site 191 1153 4 26
ENSDART00000128402 Essential Splice Site None 444 4 28
ENSDART00000083294 Essential Splice Site 191 1153 None 26
ENSDART00000128402 Essential Splice Site None 444 None 28
Genomic Location (Zv9):
Chromosome 5 (position 52558712)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50225908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCATCAARCCYAGAGTCTRTGTGGACCTTGCTGTCATCATTCCTTCTG[T/C]AAGTTATATGTTCTACTTGTCTTTTTTTCCNNNNNNNNNNTGTCTATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa841
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083294 Essential Splice Site 191 1153 4 26
ENSDART00000128402 Essential Splice Site None 444 4 28
ENSDART00000083294 Essential Splice Site 191 1153 None 26
ENSDART00000128402 Essential Splice Site None 444 None 28
Genomic Location (Zv9):
Chromosome 5 (position 52558712)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50225908
KASP Assay ID:
554-0744.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCATCAARCCCAGAGTCTRTGTGGACCTTGCTGTCATCATTCCTTCTG[T/G]AAGTTATATGTTCTACTTGTCTTTTTTTCCNNNNNNNNNNTGTCTATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38501
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083294 Essential Splice Site 293 1153 None 26
ENSDART00000128402 Essential Splice Site None 444 None 28
Genomic Location (Zv9):
Chromosome 5 (position 52562425)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50229621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAATGTAAAGACTGAATGGTTTACTGGTGTTGCAAAGGAGGAGCAAGG[T/C]AATATGGAAATATGTGAGGTCAATCATTTTAGGGGCTGTTTACACCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa962
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083294 Essential Splice Site 630 1153 14 26
ENSDART00000128402 Essential Splice Site 197 444 14 28
Genomic Location (Zv9):
Chromosome 5 (position 52572148)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50239344
KASP Assay ID:
554-0867.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGACAAGAGGCTCRTGCTTCTGGAGATCATCACTCACCTGCTACATCTG[T/G]AAGTGTCTGTTCTGTGCATATAAATCCACTTTAATACATTATAGCATAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40553
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083294 Essential Splice Site 655 1153 15 26
ENSDART00000128402 Essential Splice Site 222 444 15 28
Genomic Location (Zv9):
Chromosome 5 (position 52572404)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50239600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATTTGTTGGTGGACAACTGGATGATGTCATTAAAGTTAACAAAGAGG[T/C]ACTCCATGAACCAAATGCGTTAATAAATAAATGTGTGTGAGAAAAACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26570
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083294 Splice Site, Nonsense 702 1153 16 26
ENSDART00000128402 Splice Site, Nonsense 269 444 16 28
Genomic Location (Zv9):
Chromosome 5 (position 52572644)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50239840
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGTCCATCACATCAGTCCAGGGTGCCCACCAGGCCTTAAGATACACA[C/T]AGGTTAGCAGCCACCTCCTCCGCTGTGTGAATTTGTGTGATTTATTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7003
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083294   None 1153 None 26
ENSDART00000128402 Essential Splice Site 364 444 19 28
Genomic Location (Zv9):
Chromosome 5 (position 52575782)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50242978
KASP Assay ID:
554-4994.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGTCCTAAAAGAGTTATTGAGCACATTATTTATTAATATTTGATGYA[T/A]GCATTCATTYAATCAATTAGGATGGACTAGCCTTCCGTGTTGAAGTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38502
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083294 Nonsense 846 1153 19 26
ENSDART00000128402   None 444 None 28
Genomic Location (Zv9):
Chromosome 5 (position 52575960)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50243156
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGGCGCTGGAGCTGGAGACCCAACACAAACCTTTCCTCACCAGCACCT[T/A]GCATGGGTATGCTAACATTATCAAGTACAACACAGTTTCTTGATTTAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link