si:ch211-216l23.1

Ensembl ID:
ENSDARG00000059707
ZFIN ID:
ZDB-GENE-060503-121
Description:
Zinc finger protein 423 [Source:UniProtKB/Swiss-Prot;Acc:A1L1R6]
Human Orthologue:
ZNF423
Human Description:
zinc finger protein 423 [Source:HGNC Symbol;Acc:16762]
Mouse Orthologue:
Zfp423
Mouse Description:
zinc finger protein 423 Gene [Source:MGI Symbol;Acc:MGI:1891217]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7445 Missense Mutation detected in F1 DNA During 2017
sa6510 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083296 Missense 28 1365 2 8
ENSDART00000128003 Missense 28 1365 2 8
ENSDART00000146133 Missense 28 1275 2 5
Genomic Location (Zv9):
Chromosome 18 (position 17487120)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17838886
KASP Assay ID:
554-4082.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCGGTAGCGGTGGAAGAGGCCGARTCTACAGAGTGCGCCAGTGGTTGG[G/A]ACTCTTCTGTTCAGACAGGTATGATTTCGCTAGCGTGGCGTCCTGCACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6510
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083296 Nonsense 1177 1365 4 8
ENSDART00000128003 Nonsense 1177 1365 4 8
ENSDART00000146133 Nonsense 1177 1275 4 5
Genomic Location (Zv9):
Chromosome 18 (position 17543413)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17895179
KASP Assay ID:
554-4945.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATAGATGTCAAYGGCCTGCCTTATGGTCTTTGTGCTGGCTGCATGAGT[C/T]GAGGGACAAACGGCCAGTCCCCAACAGTTGTTGTCACCCCACARGAGGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Inattentive symptoms: Genome-wide association scan of quantitative traits for attention deficit hyperactivity disorder identifies novel associations and confirms candidate gene associations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link