flii

Ensembl ID:
ENSDARG00000059701
ZFIN ID:
ZDB-GENE-071212-3
Human Orthologue:
FLII
Human Description:
flightless I homolog (Drosophila) [Source:HGNC Symbol;Acc:3750]
Mouse Orthologue:
Flii
Mouse Description:
flightless I homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1342286]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12788 Essential Splice Site Available for shipment Available now
sa9399 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12788
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083263 Essential Splice Site 286 1260 9 30
Genomic Location:
Chromosome 3 (position 40217351)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGGAGATGYAAATTATATACTGCCTCTTCTTTTTCCATTTTTAATGCA[G/T]TCTGCCATTTGCAAGCTGTCCAAGCTGAAGAAGCTTTAYGTGAACTCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083263 Nonsense 420 1260 12 30
Genomic Location:
Chromosome 3 (position 40216048)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGAAMAATATGTACACTTTTGTGTGTCTTTGTATACAGGAAATAGCCCA[C/T]GAGACCATATGGCCAGGAAAATGAGGCTRAGGAGATGCAAGGACTCTGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pm62rgpu