agmat

Ensembl ID:
ENSDARG00000059700
ZFIN ID:
ZDB-GENE-060929-696
Description:
agmatine ureohydrolase [Source:RefSeq peptide;Acc:NP_001071019]
Human Orthologue:
AGMAT
Human Description:
agmatine ureohydrolase (agmatinase) [Source:HGNC Symbol;Acc:18407]
Mouse Orthologue:
Agmat
Mouse Description:
agmatine ureohydrolase (agmatinase) Gene [Source:MGI Symbol;Acc:MGI:1923236]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17902 Nonsense Available for shipment Available now
sa17858 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17902
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083271 Nonsense 167 366 2 7
Genomic Location:
Chromosome 23 (position 37583682)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGCAAAAAAATACAGGAGGCTTAYCGTAAAATCGTGRCCACCGGCTG[C/A]ATCCCACTAACCCTGGGTGAGAACTRCACAGATATTAAAGKTTTCMGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17858
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083271 Nonsense 243 366 4 7
Genomic Location:
Chromosome 23 (position 37584073)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTGGACTGCAAGAGGGTTGCCCAGATCGGGCTYAGAGGATCYGGTTA[T/G]TCTCCAGATAATTATGAGTGGAGCCGAGGACAGGTATCATCATGCATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hu2nvatx