LOC559762

Ensembl ID:
ENSDARG00000059699
Human Orthologue:
DNAJC16
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 16 [Source:HGNC Symbol;Acc:29157]
Mouse Orthologue:
Dnajc16
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 16 Gene [Source:MGI Symbol;Acc:MGI:2442146]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3227 Nonsense F2 line generated During 2014
sa16255 Nonsense Available for shipment Available now
sa7509 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3227
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083267 Nonsense 21 781 1 14
Genomic Location:
Chromosome 23 (position 37612562)
KASP Assay ID:
554-3024.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGTCACGATGCGGACGGTGGTGGGGTTGCTCTCTGTGATTATGCTGTA[T/A]GTGCTCCTGAATGATGCTACGGTGGAAAGCACTGCAGAATTTGATCCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16255
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083267 Nonsense 235 781 4 14
Genomic Location:
Chromosome 23 (position 37606489)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCCATCCATCCTTGGTGTCGTCAATGGAAAAGTCTCTTTCTTTCATTA[C/A]GCWGTCGTCAAAGAACACKTGATACAGTTTGTAGATGACTTGCTGCCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7509
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083267 Missense 655 781 14 14
Genomic Location:
Chromosome 23 (position 37595752)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGTCTTYTGCATGCTACTGTATGYTTCCTCTTCCTCACAGGAGTTTGA[C/T]GCTCCACTTCTCCTTYCTGAATGTGGATAAACACAAAGAATGGATGGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uhxf0k9f