ADAM33

Ensembl ID:
ENSDARG00000059693
Description:
ADAM metallopeptidase domain 33 [Source:HGNC Symbol;Acc:15478]
Human Orthologue:
ADAM33
Human Description:
ADAM metallopeptidase domain 33 [Source:HGNC Symbol;Acc:15478]
Mouse Orthologue:
Adam33
Mouse Description:
a disintegrin and metallopeptidase domain 33 Gene [Source:MGI Symbol;Acc:MGI:1341813]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27079 Splice Site, Nonsense Mutation detected in F1 DNA During 2015
sa18897 Nonsense Mutation detected in F1 DNA During 2015
sa10412 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083255 Splice Site, Nonsense 536 944 14 23
Genomic Location:
Chromosome 7 (position 61966571)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGCATGTGTCTGACCCATGAACAGCAGTGCCTGCAGCTGTGGGGTTA[C/A]GGTAAGATACATGCTGGCTGGCCGTGTGCCTTTAGTTTTCACAGAAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083255 Nonsense 934 944 23 23
ENSDART00000083255 Nonsense 934 944 23 23
Genomic Location:
Chromosome 7 (position 62002515)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCTAATGAGTGTTTTTTTTTTTTTTTTTCAGACCTGCTTCTGGACCC[A/T]AACCACTTATAGTTCCAGCCGTTTTCCGGAAATGACGCTTGCAGGATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10412
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083255 Nonsense 934 944 23 23
ENSDART00000083255 Nonsense 934 944 23 23
Genomic Location:
Chromosome 7 (position 62002515)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACCTAATGAGTGTTTTTTTTTTTTTTTTTCAGACCTGCTTCTGGACCC[A/T]AACCACTYATAGTTCCAGCCGTTTTCCGGAAATGACGCTTGCAGGATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x2gmtqrt