ADAM33

Ensembl ID:
ENSDARG00000059693
Description:
ADAM metallopeptidase domain 33 [Source:HGNC Symbol;Acc:15478]
Human Orthologue:
ADAM33
Human Description:
ADAM metallopeptidase domain 33 [Source:HGNC Symbol;Acc:15478]
Mouse Orthologue:
Adam33
Mouse Description:
a disintegrin and metallopeptidase domain 33 Gene [Source:MGI Symbol;Acc:MGI:1341813]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18897 Nonsense Mutation detected in F1 DNA During 2014
sa10412 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083255 Nonsense 934 944 23 23
ENSDART00000083255 Nonsense 934 944 23 23
Genomic Location:
Chromosome 7 (position 62002515)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCTAATGAGTGTTTTTTTTTTTTTTTTTCAGACCTGCTTCTGGACCC[A/T]AACCACTTATAGTTCCAGCCGTTTTCCGGAAATGACGCTTGCAGGATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10412
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083255 Nonsense 934 944 23 23
ENSDART00000083255 Nonsense 934 944 23 23
Genomic Location:
Chromosome 7 (position 62002515)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACCTAATGAGTGTTTTTTTTTTTTTTTTTCAGACCTGCTTCTGGACCC[A/T]AACCACTYATAGTTCCAGCCGTTTTCCGGAAATGACGCTTGCAGGATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x2gmtqrt