NP_001038387.1

Ensembl ID:
ENSDARG00000059692
Description:
sodium channel, voltage gated, type XII, alpha a [Source:RefSeq peptide;Acc:NP_001038387]
Human Orthologues:
SCN10A, SCN11A, SCN5A
Human Descriptions:
sodium channel, voltage-gated, type V, alpha subunit [Source:HGNC Symbol;Acc:10593]
sodium channel, voltage-gated, type X, alpha subunit [Source:HGNC Symbol;Acc:10582]
sodium channel, voltage-gated, type XI, alpha subunit [Source:HGNC Symbol;Acc:10583]
Mouse Orthologues:
Scn10a, Scn11a, Scn5a
Mouse Descriptions:
sodium channel, voltage-gated, type V, alpha Gene [Source:MGI Symbol;Acc:MGI:98251]
sodium channel, voltage-gated, type X, alpha Gene [Source:MGI Symbol;Acc:MGI:108029]
sodium channel, voltage-gated, type XI, alpha Gene [Source:MGI Symbol;Acc:MGI:1345149]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33047 Essential Splice Site Mutation detected in F1 DNA During 2017
sa15768 Nonsense Available for shipment Available now
sa39947 Nonsense Mutation detected in F1 DNA During 2017
sa12942 Nonsense Available for shipment Available now
sa25126 Nonsense Mutation detected in F1 DNA During 2017
sa19899 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33047
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083256 Essential Splice Site 339 1027 6 12
Genomic Location (Zv9):
Chromosome 2 (position 51498050)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 52305399
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGCTCTGCGACCCCTGAGGGCCCTATCTAGATTTGAAGGAATGAGGG[T/A]AAGATGCTTTCTTCTGTATTTTTCAATTACCTAAACATTTAGTAATACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15768
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083256 Nonsense 563 1027 11 12
Genomic Location (Zv9):
Chromosome 2 (position 51504826)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 52296978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATAACCATYATGATGCTCATTATCCTCAATATGATAACCATGATGGTT[G/T]AGACTGATGAACAATCTGCTCGCATGGAGACCATCCTCAATAACATCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083256 Nonsense 647 1027 12 12
Genomic Location (Zv9):
Chromosome 2 (position 51505386)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 52296416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTGTCTCCCCAACTCTTTTTCGAGTCATCCGGTTGGCAAGAATAGGA[C/T]GAGTTCTTCGACTGATACGAGCAGCTAAGGGAATAAGGACTTTACTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12942
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083256 Nonsense 728 1027 12 12
Genomic Location (Zv9):
Chromosome 2 (position 51505630)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 52296172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCGGGAACAGCATGATCTGYCTTTTCCAGATCACCACATCGGCCGGTT[G/A]GAATAACCTGCTGGATCCTATCCTGAACAACTCTCCGGAAGAGTGTAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25126
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083256 Nonsense 971 1027 12 12
Genomic Location (Zv9):
Chromosome 2 (position 51506358)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 52295444
KASP Assay ID:
554-7714.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGAAGAGGACAGCGCTCCAGAGCAGGAAGGTCTTATAGCGTCTATGATT[A/T]AAGAGAACTATGGCCCTGAGAAAATGGTGGGTACACTGTGCTATGCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19899
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083256 Nonsense 1023 1027 12 12
Genomic Location (Zv9):
Chromosome 2 (position 51506514)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 52295288
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATATCTGACTCTAGATCCAATGAGCCTCATAAATCAGAAGAGACATAC[G/T]AAGAGACCTTTCTTTAGGAACTCTTTTCATAGTAGGCAGTCATTATTTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link