A4QN61_DANRE

Ensembl ID:
ENSDARG00000059685
Description:
LOC567031 protein [Source:UniProtKB/TrEMBL;Acc:A4QN61]
Human Orthologue:
WDR47
Human Description:
WD repeat domain 47 [Source:HGNC Symbol;Acc:29141]
Mouse Orthologue:
Wdr47
Mouse Description:
WD repeat domain 47 Gene [Source:MGI Symbol;Acc:MGI:2139593]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19379 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083218 Essential Splice Site 104 437 8 13
ENSDART00000121497 Essential Splice Site 561 894 10 15
Genomic Location:
Chromosome Zv9_scaffold3544 (position 61734)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTAAATGAACGCAGTTTGAGGCCTTAATCTAAATGATATTTTATGACA[G/A]TGTGTTCCAGGATGAGAAGCCCAAATCCCCTTTCATAGCAGTGCAGACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qd8j16t9