si:ch211-117c19.1

Ensembl ID:
ENSDARG00000059678
ZFIN ID:
ZDB-GENE-060526-15
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KPW5]
Human Orthologue:
KIAA1161
Human Description:
KIAA1161 [Source:HGNC Symbol;Acc:19918]
Mouse Orthologue:
AI464131
Mouse Description:
expressed sequence AI464131 Gene [Source:MGI Symbol;Acc:MGI:2140300]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11500 Nonsense Available for shipment Available now
sa9561 Nonsense Available for shipment Available now
sa20537 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11500
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083208 Nonsense 269 663 2 2
ENSDART00000083208 Nonsense 269 663 2 2
Genomic Location (Zv9):
Chromosome 5 (position 56381290)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51857560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCRATATTTCAACAAGCCCAATAAGRTTCCATCAGAAGCTGTTTTCAAA[C/T]AACCAATCTGGTCTACAGGAGCTCTAGAAGAAGYYAACCAAGAAAGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9561
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083208 Nonsense 269 663 2 2
ENSDART00000083208 Nonsense 269 663 2 2
Genomic Location (Zv9):
Chromosome 5 (position 56381290)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51857560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCRATATTTCAACAAGCCCAATAAGRTTCCATCAGAAGCTGTTTTCAAA[C/T]AACCAATCTGGTCTACAGGAGCTCTAGAAGAAGYYAACCAAGAAAGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20537
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083208 Nonsense 597 663 2 2
Genomic Location (Zv9):
Chromosome 5 (position 56380304)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51856574
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCATCATTCGCCCTCTTTGGTGGATTGCTACAGATGATGAGGCTGCCTA[C/A]AAAATTGACTCTCAGTTCCTCATAGGAGATGACCTTCTTGTGGCACCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link