si:ch211-117c19.2

Ensembl ID:
ENSDARG00000059677
ZFIN ID:
ZDB-GENE-060526-16
Description:
MAM domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001123869]
Human Orthologue:
MAMDC2
Human Description:
MAM domain containing 2 [Source:HGNC Symbol;Acc:23673]
Mouse Orthologue:
Mamdc2
Mouse Description:
MAM domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1918988]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12046 Essential Splice Site Available for shipment Available now
sa33721 Nonsense Mutation detected in F1 DNA During 2017
sa40564 Nonsense Mutation detected in F1 DNA During 2017
sa6065 Nonsense Mutation detected in F1 DNA During 2017
sa13995 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12046
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083203 Essential Splice Site 11 680 2 14
Genomic Location (Zv9):
Chromosome 5 (position 56445868)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51922138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTAAAGCTTTATAGTTTGGCTTTATTGATGTGAKGTTCTGTSTCTTC[A/G]GCTGTGGCTCTTGTAGCGCGGTCTCAGACGCAGCTTTTGCGGGGCTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083203 Nonsense 87 680 3 14
Genomic Location (Zv9):
Chromosome 5 (position 56424775)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51901045
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGTCCGGAGCTGGAGCTCAGAGACTGGAGCTGTGTGCGGCTGGTCTAT[C/T]AGATCTCAGGCTCAGGATCTCTTCAATTGCACTTGCGATCCGAGGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40564
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083203 Nonsense 336 680 8 14
Genomic Location (Zv9):
Chromosome 5 (position 56403722)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51879992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATATCACTCATGTTTCAGAGCCAGAGATTGACCCGTCTGTTGCAAACTG[T/A]GACTTTGAGGAGGGCCTGTGTCAGTATTATCAGGAACAGACTGGAGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083203 Nonsense 538 680 11 14
Genomic Location (Zv9):
Chromosome 5 (position 56390239)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51866509
KASP Assay ID:
554-3846.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAGGACATTGGCTAAGGATTCGAGGACAGACGCCCACATCTTACACC[G/T]GACCCAAGGGGGACCACACCTTAGGGGTAGGTGAGTCAGATTTATACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13995
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083203 Nonsense 554 680 12 14
Genomic Location (Zv9):
Chromosome 5 (position 56390101)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51866371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AKYACACTAAGTTTCTCCTAYTCTGACTTCAAGGTTACTTCATGTACATT[G/T]AGGCCTCCCAYATGTTACCTAAGCAGTCAGCCCAGCTGATGTCCACTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link