si:ch211-204a13.4

Ensembl ID:
ENSDARG00000059674
ZFIN ID:
ZDB-GENE-060503-399
Description:
low-density lipoprotein receptor-related protein 12 [Source:RefSeq peptide;Acc:NP_001076537]
Human Orthologue:
LRP12
Human Description:
low density lipoprotein receptor-related protein 12 [Source:HGNC Symbol;Acc:31708]
Mouse Orthologue:
Lrp12
Mouse Description:
low density lipoprotein-related protein 12 Gene [Source:MGI Symbol;Acc:MGI:2443132]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43251 Nonsense Mutation detected in F1 DNA During 2017
sa36809 Splice Site, Nonsense Available for shipment Available now
sa17601 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109024 Nonsense 166 874 5 7
ENSDART00000134256 Nonsense 142 850 5 7
Genomic Location (Zv9):
Chromosome 19 (position 17184750)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 13471913
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCTTGCAATTTGCAGGGAAATCAGAAGAAGCCAGCTGCAAACCTGAC[C/T]AATTTCACTGCGCCAATGGGAAATGTATCCCGGAGTCATGGAAGTGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36809
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109024 Nonsense 562 874 6 7
ENSDART00000134256 Splice Site None 850 None 7
Genomic Location (Zv9):
Chromosome 19 (position 17183420)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 13473243
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTGATTGCTCAAGGACTGATCCCCCCAGTGGAAGATTTTCCTGTCTG[C/A]TCTGGAAATCAGGCAAGGAGACAAATAAGAAAATTGCATATTTAAATGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17601
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109024 Nonsense 813 874 7 7
ENSDART00000134256 Nonsense 789 850 7 7
Genomic Location (Zv9):
Chromosome 19 (position 17179237)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 13477426
KASP Assay ID:
2261-3136.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGGCCGGTTCCCTGGACAGTGATGAGAGCTCCAGGCCCCTACTGGAA[C/T]AAGGTCTGGAGCAGGTCTTTGGCCCACATCTTGCTCCGGCTGCYGTCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link