man2a1

Ensembl ID:
ENSDARG00000059669
ZFIN ID:
ZDB-GENE-060526-31
Description:
mannosidase, alpha, class 2A, member 1 [Source:RefSeq peptide;Acc:NP_001103497]
Human Orthologue:
MAN2A1
Human Description:
mannosidase, alpha, class 2A, member 1 [Source:HGNC Symbol;Acc:6824]
Mouse Orthologue:
Man2a1
Mouse Description:
mannosidase 2, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:104669]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9369 Nonsense Mutation detected in F1 DNA During 2014
sa3514 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9630 Nonsense Available for shipment Available now
sa5324 Nonsense Mutation detected in F1 DNA During 2014
sa10617 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9369
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083160 None None 444 None 8
ENSDART00000121500 None None 366 None 6
ENSDART00000123640 None None 292 None 6
ENSDART00000143309 Nonsense 549 1100 10 21
Genomic Location:
Chromosome 5 (position 58503625)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTCTCTGACCTTGGCCAACATTCAGAAGTACGGGCAGCCCAGTGATYA[C/A]CCTGCCGGGGAGAATTACAAACTACTGACTGAAGCCAGRCGCAATCTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083160 None None 444 None 8
ENSDART00000121500 None None 366 None 6
ENSDART00000123640 None None 292 None 6
ENSDART00000143309 Essential Splice Site 627 1100 11 21
Genomic Location:
Chromosome 5 (position 58501308)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACAAACAAACATACCACAACGATCCTTCAAAAGCCTTTCTTCAGATGG[T/C]GAGTGTTCACACTGCATATCCACAACATGCTGGCCTCRCTCCTAAATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9630
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083160 None None 444 None 8
ENSDART00000121500 None None 366 None 6
ENSDART00000123640 None None 292 None 6
ENSDART00000143309 Nonsense 720 1100 14 21
Genomic Location:
Chromosome 5 (position 58498264)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACAGTTGTCATTTGTGGCTCATGCTGCTCCTCTGGGTCTGAGCGTGTA[C/A]CAGCTGATTGAGGTAATGGAGCCCAGGACAGATGCTTCGAAGTACATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5324
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083160 None None 444 None 8
ENSDART00000121500 None None 366 None 6
ENSDART00000123640 None None 292 None 6
ENSDART00000143309 Nonsense 803 1100 15 21
Genomic Location:
Chromosome 5 (position 58497920)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGGAAGATGAATCTGAGCACCAAATGAAGGTGGAGTTTGTTTGGTAT[G/T]GAACCACCAGCAGTAAAGACAAGAGYGGCGCCTACCTATTCCTGCCCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10617
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083160 None None 444 None 8
ENSDART00000121500 None None 366 None 6
ENSDART00000123640 Nonsense 149 292 4 6
ENSDART00000143309 Nonsense 1007 1100 20 21
Genomic Location:
Chromosome 5 (position 58428468)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACTTTCCTGTATTTKACCCAGAATGAAGCGACKGCACCATACAGCTA[T/G]CCATCTATCCTGAGCCACATGTCRTACATGTACCTGAACCATCCTCTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7zl8m5wi