mrm1

Ensembl ID:
ENSDARG00000059658
ZFIN ID:
ZDB-GENE-060526-229
Description:
Novel protein similar to vertebrate mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) (
Human Orthologue:
MRM1
Human Description:
mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:26202]
Mouse Orthologue:
Mrm1
Mouse Description:
mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:24434

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38510 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38510
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083137 Essential Splice Site 276 291 4 5
Genomic Location (Zv9):
Chromosome 5 (position 57532043)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55452642
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGACACATGCATCCTGGAGTAGAGTCACTCAACGTGTCGGTAGCCACAG[G/A]TATGCCTTTCTCAAGTATATAAATATTGTTTAAAAGTTTTTTTAAAAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link