mks1

Ensembl ID:
ENSDARG00000059657
ZFIN ID:
ZDB-GENE-030131-3813
Description:
meckel syndrome, type 1 [Source:RefSeq peptide;Acc:NP_001070841]
Human Orthologue:
MKS1
Human Description:
Meckel syndrome, type 1 [Source:HGNC Symbol;Acc:7121]
Mouse Orthologue:
Mks1
Mouse Description:
Meckel syndrome, type 1 Gene [Source:MGI Symbol;Acc:MGI:3584243]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20540 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40567 Essential Splice Site Mutation detected in F1 DNA During 2016
sa7574 Missense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20540
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083134 Essential Splice Site 26 559 1 18
Genomic Location (Zv9):
Chromosome 5 (position 57527920)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55448519
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAATCGGTTTACCGTTCCAGGGATGCAGTTAAAAACTTCCGAATACGG[T/G]AAGACACGTCGCCTGTGTGCATGTATAACAAACTGATGTATATATTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40567
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083134 Essential Splice Site 67 559 2 18
Genomic Location (Zv9):
Chromosome 5 (position 57525530)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55446129
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGAGGAGTTATAGAGTTGGAAACCTTCAGCACTCAGACGGCCTCCTG[T/A]ATGTCAAAGACAGATATTAACCTGATAAAGGGATGGCTCACACAACAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083134 Missense 531 559 18 18
Genomic Location (Zv9):
Chromosome 5 (position 57500295)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55420894
KASP Assay ID:
554-4208.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTAAAAATCTGCTGTTTGTTTGTGATTTTTCAGAAGCGTTTCAGAGGG[C/A]CCATAAGCGCATGCARGAGGCCAGAGAGACTTTACCCAGAGACCTCATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link