mks1

Ensembl ID:
ENSDARG00000059657
ZFIN ID:
ZDB-GENE-030131-3813
Description:
meckel syndrome, type 1 [Source:RefSeq peptide;Acc:NP_001070841]
Human Orthologue:
MKS1
Human Description:
Meckel syndrome, type 1 [Source:HGNC Symbol;Acc:7121]
Mouse Orthologue:
Mks1
Mouse Description:
Meckel syndrome, type 1 Gene [Source:MGI Symbol;Acc:MGI:3584243]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20540 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7574 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20540
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083134 Essential Splice Site 26 559 1 18
Genomic Location:
Chromosome 5 (position 57527920)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAATCGGTTTACCGTTCCAGGGATGCAGTTAAAAACTTCCGAATACGG[T/G]AAGACACGTCGCCTGTGTGCATGTATAACAAACTGATGTATATATTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083134 Missense 531 559 18 18
Genomic Location:
Chromosome 5 (position 57500295)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTAAAAATCTGCTGTTTGTTTGTGATTTTTCAGAAGCGTTTCAGAGGG[C/A]CCATAAGCGCATGCARGAGGCCAGAGAGACTTTACCCAGAGACCTCATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e8qc4ild