eif3b

Ensembl ID:
ENSDARG00000059654
ZFIN ID:
ZDB-GENE-030131-2748
Human Orthologue:
EIF3B
Human Description:
eukaryotic translation initiation factor 3, subunit B [Source:HGNC Symbol;Acc:3280]
Mouse Orthologue:
Eif3b
Mouse Description:
eukaryotic translation initiation factor 3, subunit B Gene [Source:MGI Symbol;Acc:MGI:106478]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40138 Nonsense Mutation detected in F1 DNA During 2016
sa16634 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083129 Nonsense 122 683 3 18
Genomic Location (Zv9):
Chromosome 3 (position 41711689)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 41575049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTCTGCACCAAGTCACGCTCATGAAGCGGTCAAAAACGCTGATGGCTA[C/A]AAGCTGGACAAGCAGCACACCTTCCGTGTCAATCTGTTCACTGACTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16634
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083129 Nonsense 179 683 5 18
Genomic Location (Zv9):
Chromosome 3 (position 41713779)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 41577139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCCACTGGATGGAGGATCCTGAYTGTCGTGATCAGTACAGYGTWATCTA[T/G]GACTCTGGTGAAAGAAYGGGCATATTCGCCAATGATGTCAAGGAGCCTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link