kdm2aa

Ensembl ID:
ENSDARG00000059653
ZFIN ID:
ZDB-GENE-061215-144
Description:
lysine (K)-specific demethylase 2B isoform 2 [Source:RefSeq peptide;Acc:NP_001075161]
Human Orthologues:
FBXL19, KDM2A, KDM2B
Human Descriptions:
F-box and leucine-rich repeat protein 19 [Source:HGNC Symbol;Acc:25300]
lysine (K)-specific demethylase 2A [Source:HGNC Symbol;Acc:13606]
lysine (K)-specific demethylase 2B [Source:HGNC Symbol;Acc:13610]
Mouse Orthologues:
Fbxl19, Kdm2a, Kdm2b
Mouse Descriptions:
F-box and leucine-rich repeat protein 19 Gene [Source:MGI Symbol;Acc:MGI:3039600]
lysine (K)-specific demethylase 2A Gene [Source:MGI Symbol;Acc:MGI:1354736]
lysine (K)-specific demethylase 2B Gene [Source:MGI Symbol;Acc:MGI:1354737]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa898 Nonsense Available for shipment Available now
sa9360 Nonsense Mutation detected in F1 DNA During 2014
sa18702 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa898
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083103 None None 914 None 13
ENSDART00000083127 Nonsense 236 271 8 9
ENSDART00000106684 Nonsense 227 1215 7 32
ENSDART00000135067 None None 963 None 13
ENSDART00000147357 Nonsense 239 1242 8 21
Genomic Location:
Chromosome 1 (position 45304557)
KASP Assay ID:
554-0805.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTGGTCTGCRTCTGCTACAGGTGTTTTGGTTAATCCCTCCCACGCCT[C/T]AAAACCTGGAGCTTTATGAGAACTGGGTGTTGTCAGGGAAACAAGGCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9360
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083103 Nonsense 660 914 9 13
ENSDART00000083127 None None 271 None 9
ENSDART00000106684 Nonsense 960 1215 27 32
ENSDART00000135067 Nonsense 709 963 9 13
ENSDART00000147357 Nonsense 988 1242 17 21
ENSDART00000083103 Nonsense 660 914 9 13
ENSDART00000083127 None None 271 None 9
ENSDART00000106684 Nonsense 960 1215 27 32
ENSDART00000135067 Nonsense 709 963 9 13
ENSDART00000147357 Nonsense 988 1242 17 21
Genomic Location:
Chromosome 1 (position 45318230)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAYGAGCTCGGCTGTGAAAARGACATTTGGGTGTCTGTGTTTCGTTA[C/A]CTGGATCGGACAGATTTRGCTGTGTGCATGAGAGTCTGCAAGGCTTGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18702
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083103 Nonsense 660 914 9 13
ENSDART00000083127 None None 271 None 9
ENSDART00000106684 Nonsense 960 1215 27 32
ENSDART00000135067 Nonsense 709 963 9 13
ENSDART00000147357 Nonsense 988 1242 17 21
ENSDART00000083103 Nonsense 660 914 9 13
ENSDART00000083127 None None 271 None 9
ENSDART00000106684 Nonsense 960 1215 27 32
ENSDART00000135067 Nonsense 709 963 9 13
ENSDART00000147357 Nonsense 988 1242 17 21
Genomic Location:
Chromosome 1 (position 45318230)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAACGAGCTCGGCTGTGAAAAGGACATTTGGGTGTCTGTGTTTCGTTA[C/A]CTGGATCGGACAGATTTAGCTGTGTGCATGAGAGTCTGCAAGGCTTGGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Psoriasis: Genome-wide association analysis identifies three psoriasis susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/30avfcv6