nt5dc2

Ensembl ID:
ENSDARG00000059646
ZFIN ID:
ZDB-GENE-060810-17
Description:
5'-nucleotidase domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001070611]
Human Orthologue:
NT5DC2
Human Description:
5'-nucleotidase domain containing 2 [Source:HGNC Symbol;Acc:25717]
Mouse Orthologue:
Nt5dc2
Mouse Description:
5'-nucleotidase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917271]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25393 Essential Splice Site Mutation detected in F1 DNA During 2017
sa15749 Essential Splice Site Available for shipment Available now
sa41196 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25393
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083108 Essential Splice Site 324 603 8 14

The following transcripts of ENSDARG00000059646 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 24500251)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23626069
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCAACTTTCTGCCTTTTGTGACCCTGTTTCCTTCCTTATTTGTTCTCC[A/T]GAGAAATACATTCTGCGAGGAGACGAGACGTACGCTGTGCTGCACCGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15749
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083108 Essential Splice Site 448 603 11 14

The following transcripts of ENSDARG00000059646 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 24503125)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23628943
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGATCCAAGGTTTTTTATTTTGGAGATCATCTCTACAGTGATTTGGCC[G/A]TGAGTCATCTTCATGCTTCTGTCTGCACATTTGTTGSGCATATGCCYGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083108 Essential Splice Site 495 603 12 14

The following transcripts of ENSDARG00000059646 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 24504368)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23630186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGTCTCACGTGGCTGCAGGCGCTTACTGGGCTGCTAGAGCGCATGCAG[G/A]TGAGCATTAAGACTTCTTCAAAATGCTTCCTGTTGAGCGTTGCTAAATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link