si:ch211-127d4.3

Ensembl ID:
ENSDARG00000059636
ZFIN ID:
ZDB-GENE-060526-22
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2ATY2]
Human Orthologue:
C2orf42
Human Description:
chromosome 2 open reading frame 42 [Source:HGNC Symbol;Acc:26056]
Mouse Orthologue:
C87436
Mouse Description:
expressed sequence C87436 Gene [Source:MGI Symbol;Acc:MGI:2141787]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20545 Nonsense Available for shipment Available now
sa20544 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20545
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083074 Nonsense 197 556 3 12
ENSDART00000146991 Nonsense 58 391 1 7
Genomic Location (Zv9):
Chromosome 5 (position 58352076)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 56272675
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGGACCTTTAGTTCAGAGGGTCTCCAAAGGGACACTGATAGTAAAGTG[T/A]CAGCCAGGAGAAGCCCACCCTTTGGGATTGCTGCATCTTACAGTGGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20544
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083074 Essential Splice Site 352 556 7 12
ENSDART00000146991 Essential Splice Site 193 391 3 7
Genomic Location (Zv9):
Chromosome 5 (position 58348310)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 56268909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTATTTTAGCTGATTTTGATGTGTGTTATGTGCTGGGGTGAATAACAC[A/C]GGAAGCAGTCAGCCGGTGGATGAGACGCATGTGTCACTGAGTTTCCAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link