thumpd3

Ensembl ID:
ENSDARG00000059634
ZFIN ID:
ZDB-GENE-030131-9745
Description:
THUMP domain-containing protein 3 [Source:RefSeq peptide;Acc:NP_001082863]
Human Orthologue:
THUMPD3
Human Description:
THUMP domain containing 3 [Source:HGNC Symbol;Acc:24493]
Mouse Orthologue:
Thumpd3
Mouse Description:
THUMP domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1277973]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8793 Nonsense Mutation detected in F1 DNA During 2014
sa8825 Nonsense Mutation detected in F1 DNA During 2014
sa1193 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8793
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083070 Nonsense 333 477 7 11
ENSDART00000135959 Nonsense 338 482 7 10
ENSDART00000136271 None None 152 None 4
ENSDART00000143378 None None 236 None 4
ENSDART00000146307 None None 193 None 4
ENSDART00000147507 None None 271 None 5
ENSDART00000083070 Nonsense 333 477 7 11
ENSDART00000135959 Nonsense 338 482 7 10
ENSDART00000136271 None None 152 None 4
ENSDART00000143378 None None 236 None 4
ENSDART00000146307 None None 193 None 4
ENSDART00000147507 None None 271 None 5

The following transcripts of ENSDARG00000059634 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 23686375)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAGTCAGCCGATCAGTCAAYAATATCAAGCACATTCTGAAGAAAACA[C/T]AGGATGGAGGAAGGTGAGGCTTTTGATCGTSTCCTGTAAACYTTTTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8825
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083070 Nonsense 333 477 7 11
ENSDART00000135959 Nonsense 338 482 7 10
ENSDART00000136271 None None 152 None 4
ENSDART00000143378 None None 236 None 4
ENSDART00000146307 None None 193 None 4
ENSDART00000147507 None None 271 None 5
ENSDART00000083070 Nonsense 333 477 7 11
ENSDART00000135959 Nonsense 338 482 7 10
ENSDART00000136271 None None 152 None 4
ENSDART00000143378 None None 236 None 4
ENSDART00000146307 None None 193 None 4
ENSDART00000147507 None None 271 None 5

The following transcripts of ENSDARG00000059634 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 23686375)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAGTCAGCCGATCAGTCAAYAATATCAAGCACATTCTGAAGAAAACA[C/T]AGGATGGAGGAAGGTGAGGCTTTTGATCGTSTCCTGTAAACYTTTTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1193
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083070 Nonsense 347 477 8 11
ENSDART00000135959 Nonsense 352 482 8 10
ENSDART00000136271 None None 152 None 4
ENSDART00000143378 None None 236 None 4
ENSDART00000146307 None None 193 None 4
ENSDART00000147507 None None 271 None 5

The following transcripts of ENSDARG00000059634 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 23689053)
KASP Assay ID:
554-1102.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTCTTATTTTCTATTTATAGCCCCTCGGGCTTGCCCTTAGACATTGTG[C/T]AGTGGGACTTGTGCAATTTGCCCATGAGAAGCAGTTCAGTGGACATCATC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kxb9jtn8