ints1

Ensembl ID:
ENSDARG00000059631
ZFIN ID:
ZDB-GENE-030131-6523
Human Orthologue:
INTS1
Human Description:
integrator complex subunit 1 [Source:HGNC Symbol;Acc:24555]
Mouse Orthologue:
Ints1
Mouse Description:
integrator complex subunit 1 Gene [Source:MGI Symbol;Acc:MGI:1915760]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20113 Nonsense Mutation detected in F1 DNA During 2016
sa18206 Nonsense Available for shipment Available now
sa40146 Nonsense Mutation detected in F1 DNA During 2016
sa14215 Nonsense Available for shipment Available now
sa20112 Essential Splice Site Available for shipment Available now
sa40145 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083062 Nonsense 528 2194 10 47
Genomic Location (Zv9):
Chromosome 3 (position 43604041)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 42305439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAGTCCTTCTGTTTAGGCCTCATGCAGGAGAGGAAAGAGGCCACTTA[T/A]GTGGACATGGAGTTTAAAGTGAGCACTGGATTGCTGCATTTGTGTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18206
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083062 Nonsense 624 2194 13 47
Genomic Location (Zv9):
Chromosome 3 (position 43601337)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 42308143
KASP Assay ID:
2259-3977.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNTTTTCAACAGCCTCCACAAGGTGCTTTTCACCGAGCAGCCTGARACGTA[T/A]TATAAATGGGAMAACTGGCCTCCTGAGAGTGACAGAAAGTGAGTTACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083062 Nonsense 625 2194 13 47
Genomic Location (Zv9):
Chromosome 3 (position 43601334)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 42308146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAACAGCCTCCACAAGGTGCTTTTCACCGAGCAGCCTGAAACGTATTA[T/A]AAATGGGACAACTGGCCTCCTGAGAGTGACAGAAAGTGAGTTACCTCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14215
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083062 Nonsense 1284 2194 28 47
Genomic Location (Zv9):
Chromosome 3 (position 43588675)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 42320805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTGTGCMAAAAGATACTAGCATTATGTGTGTTATTGCCTGTTAGATTA[T/A]ATGGCTCATCTGGTGGAGGTCCAGCATGAGAGAGGAGCCACAGGAGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20112
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083062 Essential Splice Site 1540 2194 32 47
Genomic Location (Zv9):
Chromosome 3 (position 43583394)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 42326086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGAGCTGGAGAAAAGTGCAATGCTGAACCTGAACTCATCAGAAAAGG[T/C]ATTTTAGTGGGATTTTTTTCACCAGGAAATATAGTTTTGACTACTTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40145
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083062 Essential Splice Site 1797 2194 38 47
Genomic Location (Zv9):
Chromosome 3 (position 43567031)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 42342449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTTTATTGGCAGTTTAAGTAGTTATTTATTGTTTGTGTGCTGTTTAC[A/G]GTATAATGAGTAAGAAGTGTCAGACGCTGCTGCTTCAGATCTATCTGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link