mlec

Ensembl ID:
ENSDARG00000059630
ZFIN ID:
ZDB-GENE-081105-187
Description:
Malectin [Source:UniProtKB/Swiss-Prot;Acc:A9C3P0]
Human Orthologue:
MLEC
Human Description:
malectin [Source:HGNC Symbol;Acc:28973]
Mouse Orthologue:
Mlec
Mouse Description:
malectin Gene [Source:MGI Symbol;Acc:MGI:1924015]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8321 Nonsense Mutation detected in F1 DNA During 2014
sa18925 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8321
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083068 Nonsense 219 285 5 5
ENSDART00000131372 Nonsense 219 285 6 6
ENSDART00000083068 Nonsense 219 285 5 5
ENSDART00000131372 Nonsense 219 285 6 6
Genomic Location:
Chromosome 8 (position 41823947)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTTTCTTAGATGTGCCAAAACTGCAGCCCCATCCTGGCCTGGAAAAA[C/T]GAGAGGAAGAGGAAGAAGAAGAAGAGGAGGGCGAKGGGCCAGAAGGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18925
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083068 Nonsense 219 285 5 5
ENSDART00000131372 Nonsense 219 285 6 6
ENSDART00000083068 Nonsense 219 285 5 5
ENSDART00000131372 Nonsense 219 285 6 6
Genomic Location:
Chromosome 8 (position 41823947)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTTCTTAGATGTGCCAAAACTGCAGCCCCATCCTGGCCTGGAAAAA[C/T]GAGAGGAAGAGGAAGAAGAAGAAGAGGAGGGCGAGGGGCCAGAAGGTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f1ymvxyj