nprl2

Ensembl ID:
ENSDARG00000059613
ZFIN ID:
ZDB-GENE-060825-93
Description:
tumor suppressor candidate 4 [Source:RefSeq peptide;Acc:NP_001039312]
Human Orthologue:
NPRL2
Human Description:
nitrogen permease regulator-like 2 (S. cerevisiae) [Source:HGNC Symbol;Acc:24969]
Mouse Orthologue:
Nprl2
Mouse Description:
nitrogen permease regulator-like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914482]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18351 Nonsense Available for shipment Available now
sa25337 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18351
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083038 Nonsense 26 379 1 11

The following transcripts of ENSDARG00000059613 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 24053321)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 20308767
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATATTTTTYAGTGAATTTCATCCAACGTTAGGACCAAAGATCACATAT[C/T]AGGTAACATCACAGAAACCWGTATTTGGGAACARATGWATGTTTGGCWGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083038 Essential Splice Site 240 379 7 11

The following transcripts of ENSDARG00000059613 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 24039458)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 20294904
KASP Assay ID:
554-7420.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTTTTACAGGTATTATGACGTGGTAACTCTGGTATCCATATTTCAGG[T/C]ATGTTTTTTTGTTGATGTTGTTTATTCTCATTCTTGTAATGGGTTCTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link