rabep1

Ensembl ID:
ENSDARG00000059600
ZFIN ID:
ZDB-GENE-060526-165
Description:
rab GTPase-binding effector protein 1 [Source:RefSeq peptide;Acc:NP_001116759]
Human Orthologue:
RABEP1
Human Description:
rabaptin, RAB GTPase binding effector protein 1 [Source:HGNC Symbol;Acc:17677]
Mouse Orthologue:
Rabep1
Mouse Description:
rabaptin, RAB GTPase binding effector protein 1 Gene [Source:MGI Symbol;Acc:MGI:1860236]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15851 Nonsense Available for shipment Available now
sa14919 Nonsense Available for shipment Available now
sa20551 Nonsense Mutation detected in F1 DNA During 2014
sa11256 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15851
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110182 Nonsense 540 850 10 18
Genomic Location:
Chromosome 5 (position 60758821)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGCTCTAATTAYGAGAAACAACTGCAGGTYATCCAGGGACAAGAGGCC[G/T]AGACACGAGAKCAGGTTGGTGCTTCTAYGGCTTCAAAAWCAGGTCTYTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14919
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110182 Nonsense 615 850 12 18
Genomic Location:
Chromosome 5 (position 60761294)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCGCTCTMCAACAGGCCTTYAGYCAGGCCAAGAGGAAYACCCAGGAA[C/T]AGATGGTACMAGCAAAAACACTYACTCATTTTGCTTCATTAATTTCAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110182 Nonsense 738 850 15 18
Genomic Location:
Chromosome 5 (position 60770063)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCTTCCATCCTGTAGCATCTTTTTCCAGCCTAAAGACGGAACTGGAA[C/T]GAGTGAAGAGTGAGAAGGAACAGGTAGGAAAGAACACAGATATGCAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11256
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110182 Essential Splice Site 817 850 17 18
Genomic Location:
Chromosome 5 (position 60775644)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCGAGCAGGTCCAGAGAGATTTYGTCAAACTGTCCCAGACCCTTCAG[G/A]TAAATGYATTTMACTAGAAATTAAACCACAGTTTCATTTCTACACGGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tx9cxndp