LOC556406

Ensembl ID:
ENSDARG00000059596
Human Orthologue:
CLIP2
Human Description:
CAP-GLY domain containing linker protein 2 [Source:HGNC Symbol;Acc:2586]
Mouse Orthologue:
Clip2
Mouse Description:
CAP-GLY domain containing linker protein 2 Gene [Source:MGI Symbol;Acc:MGI:1313136]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15415 Nonsense Available for shipment Available now
sa8206 Nonsense Mutation detected in F1 DNA During 2014
sa20554 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15415
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082983 Nonsense 115 992 1 15
Genomic Location:
Chromosome 5 (position 61118486)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGATGAGCAGCAGAACGCRCAGCTCCAAGGTGGAGCAGGAGCYTCCGGM[C/T]AGCGCGTGGTCATGCCGCTCAGAGAAGGCATKCTWAACAGCTCYGTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8206
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082983 Nonsense 631 992 8 15
Genomic Location:
Chromosome 5 (position 61161177)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTGAAGGCCAAACATGAGATTGATGCYGCWGTGATGGCCAAAGAGCGT[G/T]AAGACTTACGCAGCCGGCTTCAGGAGCTACGGGACCAGCTTGAGGACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20554
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082983 Essential Splice Site 752 992 8 15
Genomic Location:
Chromosome 5 (position 61161544)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCGACTGCAGGCTGTAGAGGCAGATCACACCACTCAGGATGTTAATG[T/C]TAGTGACCTTTGATTCAGTAAATGATTCAATTATTTACAAAAGTTTAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6f6e6bxc