hs3st3b1a

Ensembl ID:
ENSDARG00000059594
ZFIN ID:
ZDB-GENE-070202-4
Description:
heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1a isoform 1 [Source:RefSeq peptide;Acc:NP_001
Human Orthologues:
HS3ST3A1, HS3ST3B1
Human Descriptions:
heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1 [Source:HGNC Symbol;Acc:5196]
heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1 [Source:HGNC Symbol;Acc:5198]
Mouse Orthologues:
Hs3st3a1, Hs3st3b1
Mouse Descriptions:
heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1 Gene [Source:MGI Symbol;Acc:MGI:1333861]
heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1 Gene [Source:MGI Symbol;Acc:MGI:1333853]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33303 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33303
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082987 Nonsense 291 366 2 2
ENSDART00000104579 Nonsense 188 263 3 3
ENSDART00000139496 Nonsense 209 284 3 3
Genomic Location (Zv9):
Chromosome 3 (position 50029572)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 44723992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGCTGATTAGTGATCCATCCGGAGAGATGGCTCGAGTACAGCACTTTT[T/A]GGGCCTAAGGAGGGAGGTGACGCACAAACACTTTCACTTTAACCCTGCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link