ENSDARG00000059567

Ensembl ID:
ENSDARG00000059567
Human Orthologue:
RASIP1
Human Description:
Ras interacting protein 1 [Source:HGNC Symbol;Acc:24716]
Mouse Orthologue:
Rasip1
Mouse Description:
Ras interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1917153]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20161 Nonsense Available for shipment Available now
sa20160 Nonsense Available for shipment Available now
sa10602 Nonsense Available for shipment Available now
sa18649 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20161
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082920 Nonsense 131 849 2 11
Genomic Location (Zv9):
Chromosome 3 (position 59660100)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 58736495
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGGCATCCTGAAGATATTCGGCAGTGACATCTGCCAGGGGACCAACTA[T/A]AAGAGTGTGCTGGCCACCAGTAACTCCAGTGCCAACCAGCTGGTCAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20160
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082920 Nonsense 163 849 3 11
Genomic Location (Zv9):
Chromosome 3 (position 59656491)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 58732886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTCTTGCCTCACAGGTACTGCTTGGAAAAGGAAGACCCCAGCGCTTA[T/A]GTGCTCTGCGATGTGATTGGACGAACTGGATCCGATCACGAGTGGAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10602
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082920 Nonsense 345 849 5 11
Genomic Location (Zv9):
Chromosome 3 (position 59639165)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 58715560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRAAATCCCCTGTCTSTTCTGTTCATCTCTTATCAGGAYTTTCTGATCTA[T/A]CTGATGAGCGGGAACACGTGTGTGTTCGGCAGCTCCTCTGAATCCTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18649
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082920 Nonsense 374 849 5 11
Genomic Location (Zv9):
Chromosome 3 (position 59639079)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 58715474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCKGAATCCTCCACCRGAGTGAACCAGGAGTCMCTRAAGGTGGACATTT[T/A]ACTCTTCGCTCCTGATGTTTCACCTCAGCACTGCTGCGTTCAGCGACAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link