LOC566553

Ensembl ID:
ENSDARG00000059556
Human Orthologue:
RECQL5
Human Description:
RecQ protein-like 5 [Source:HGNC Symbol;Acc:9950]
Mouse Orthologue:
Recql5
Mouse Description:
RecQ protein-like 5 Gene [Source:MGI Symbol;Acc:MGI:2156841]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26171 Essential Splice Site Mutation detected in F1 DNA During 2016
sa2129 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa26171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082886 Essential Splice Site 69 934 2 19
Genomic Location (Zv9):
Chromosome 3 (position 60432555)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 59735014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCAGTGGAGTCACTCTGGTCATTTCTCCTCTGATCGCCCTCATTCAGG[T/C]ACCCCCCCCCCATCTCCCAAACACATGCTAATATACACTATATTGGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2129
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082886 Nonsense 856 934 17 19
ENSDART00000082886 Nonsense 856 934 17 19
Genomic Location (Zv9):
Chromosome 3 (position 60400482)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 59702941
KASP Assay ID:
554-3428.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGAATGGAGACGGTGCTGGGATCTCRAGGAAGYCTGTSACGCTCAAA[G/T]AAGCTGCWGACATMGTGGTGCGCTGCCTCGACCCCTTCTACAAACAAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link