LOC566553

Ensembl ID:
ENSDARG00000059556
Human Orthologue:
RECQL5
Human Description:
RecQ protein-like 5 [Source:HGNC Symbol;Acc:9950]
Mouse Orthologue:
Recql5
Mouse Description:
RecQ protein-like 5 Gene [Source:MGI Symbol;Acc:MGI:2156841]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26171 Essential Splice Site Mutation detected in F1 DNA During 2015
sa5237 Nonsense Mutation detected in F1 DNA During 2015
sa2129 Nonsense F2 line generated During 2015

Mutation Details

Allele Name:
sa26171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082886 Essential Splice Site 69 934 2 19
Genomic Location:
Chromosome 3 (position 60432555)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCAGTGGAGTCACTCTGGTCATTTCTCCTCTGATCGCCCTCATTCAGG[T/C]ACCCCCCCCCCATCTCCCAAACACATGCTAATATACACTATATTGGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082886 Nonsense 252 934 4 19
Genomic Location:
Chromosome 3 (position 60428969)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTAAGCACCCACTTTTTNGCTTTTGCAGGGATGTGGGATTGTTTACTGT[C/T]GAACGCGAGAGAGTTGCGAGGAAGTGGCTCATAAGTTGACCAAATTAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2129
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082886 Nonsense 856 934 17 19
ENSDART00000082886 Nonsense 856 934 17 19
Genomic Location:
Chromosome 3 (position 60400482)
KASP Assay ID:
554-3428.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGAATGGAGACGGTGCTGGGATCTCRAGGAAGYCTGTSACGCTCAAA[G/T]AAGCTGCWGACATMGTGGTGCGCTGCCTCGACCCCTTCTACAAACAAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/51doxwe3